WormMine: Gene WBGene00041129

• WormBase Gene ID: WBGene00041129
• Gene Name: CBG22605
• Sequence Name: CBG22605
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: CUB-like domain. Is an ortholog of C. elegans ZK1037.6; T19C9.8; and T05E12.6. In C. elegans, C29F3.7 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG22605.1	CBG22605.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG22605	CBG22605		[unknown]

0 RNAi Result

2 Allele

• WBVar00041754
• WBVar00041759

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058415
• Remark: CBG22605, TATCTTGGCACAGGATTCCAGCTTTTGAGCAACCAAGCTCAATTTGTTTCCACTGGAAAC, WBGene00041129
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term