WormMine: Gene WBGene00031390

• WormBase Gene ID: WBGene00031390
• Gene Name: CBG09876
• Sequence Name: CBG09876
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Alpha crystallin/Small heat shock protein, animal type; Alpha crystallin/Hsp20 domain; Hsp20/alpha crystallin family; and HSP20-like chaperone. Is an ortholog of C. elegans ZK1128.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09876b.1	CBG09876b.1		[unknown]
Transcript:CBG09876a.1	CBG09876a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09876a	CBG09876a		[unknown]
CDS:CBG09876b	CBG09876b		[unknown]

0 RNAi Result

15 Allele

• WBVar00034914
• WBVar00034919
• WBVar00034924
• WBVar00034909
• WBVar00006879
• WBVar00006884
• WBVar00115358
• WBVar00115359
• WBVar00115360
• WBVar00115361
• WBVar00115362
• WBVar00115363
• WBVar00115355
• WBVar00115356
• WBVar00115357

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068498
• Remark: CBG09876, AAAGTTGTGCTCACAGATGATACATTGAGCATTTCGGGAGAACGTTTTGAATCTACTGGA, WBGene00031390
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term