WormMine: Gene WBGene00031387

• WormBase Gene ID: WBGene00031387
• Gene Name: Cbr-ham-3
• Sequence Name: CBG09873
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SWIB domain; SWIB/MDM2 domain superfamily; and SWIB/MDM2 domain. Is an ortholog of C. elegans ham-3. In C. elegans, ham-3 is involved in determination of adult lifespan; negative regulation of transcription by RNA polymerase II; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09873.1	CBG09873.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09873	CBG09873		[unknown]

0 RNAi Result

5 Allele

• WBVar00034904
• WBVar00034899
• WBVar00115354
• WBVar00115352
• WBVar00115353

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059176
• Remark: Cbr-tag-246, AATGGGTTGTCAGCCAGAACACCGACTTAAAAACTCTGACCGAATCAAATGGTGATGGAG, WBGene00031387
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term