WormMine: Gene WBGene00024940

• WormBase Gene ID: WBGene00024940
• Gene Name: Cbr-qui-1
• Sequence Name: CBG01752
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; Quinoprotein alcohol dehydrogenase-like superfamily; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans qui-1. In C. elegans, qui-1 is involved in response to alkaloid.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01752.1	CBG01752.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01752	CBG01752		[unknown]

0 RNAi Result

7 Allele

• WBVar00141612
• WBVar00141613
• WBVar00141610
• WBVar00141611
• WBVar00141608
• WBVar00141609
• WBVar00044952

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060024
• Remark: Cbr-qui-1, CGGGCAGCCTGCTCCAAGGGCAACAGCTCCAAAACCAACTTTTGATATGTTGGAAAGGAG, WBGene00024940
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term