WormMine: Gene WBGene00033330

• WormBase Gene ID: WBGene00033330
• Gene Name: Cbr-cids-2
• Sequence Name: CBG12372
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: CID domain and ENTH/VHS. Is an ortholog of C. elegans cids-2. In C. elegans, cids-2 is involved in mRNA 3'-end processing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12372b.1	CBG12372b.1		[unknown]
Transcript:CBG12372a.1	CBG12372a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12372a	CBG12372a		[unknown]
CDS:CBG12372b	CBG12372b		[unknown]

0 RNAi Result

4 Allele

• WBVar00037259
• WBVar00008939
• WBVar00118464
• WBVar00118465

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060132
• Remark: Cbr-cids-2, ATATGACGACCGTAGAAATCATGACTATGATGATCGCAGAAAGTCAGCTCCGTATCCAAG, WBGene00033330
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term