WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00270432 Gene Name  CBG30108
Sequence Name  ? CBG30108 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: ShK domain-like and ShKT domain. Is an ortholog of C. elegans F01D5.5. In C. elegans, F01D5.5 is involved in innate immune response. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG30108.1 CBG30108.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG30108 CBG30108   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00129036

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG20825, CAGGAGCCACAACTGCAGTACCACCAACTGCCAATCCAAATTGCCATGATTCTAGCACTA, WBGene00039739   Expr1052570 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term