WormMine: Gene WBGene00270432

• WormBase Gene ID: WBGene00270432
• Gene Name: CBG30108
• Sequence Name: CBG30108
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: ShK domain-like and ShKT domain. Is an ortholog of C. elegans F01D5.5. In C. elegans, F01D5.5 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG30108.1	CBG30108.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG30108	CBG30108		[unknown]

0 RNAi Result

1 Allele

• WBVar00129036

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052570
• Remark: CBG20825, CAGGAGCCACAACTGCAGTACCACCAACTGCCAATCCAAATTGCCATGATTCTAGCACTA, WBGene00039739
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term