WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026756 Gene Name  CBG04004
Sequence Name  ? CBG04004 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Cysteine/serine-rich nuclear protein family; Cysteine/serine-rich nuclear protein N-terminus; and Cysteine/serine-rich nuclear protein, N-terminal domain. Is an ortholog of C. elegans C41D11.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04004.1 CBG04004.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04004 CBG04004   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00108916

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG04004, ACGGGTATCACTGGAAGTCCGCAGGTCACAAAGTTTGTAGATAGTGACGATAAAGAGGAT, WBGene00026756   Expr1059483 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term