WormMine: Gene WBGene00035501

• WormBase Gene ID: WBGene00035501
• Gene Name: Cbr-zer-1
• Sequence Name: CBG15177
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat domain superfamily; Zyg eleven-related protein 1; Armadillo-type fold; and Armadillo-like helical. Is an ortholog of C. elegans zer-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15177b.1	CBG15177b.1		[unknown]
Transcript:CBG15177a.1	CBG15177a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15177b	CBG15177b		[unknown]
CDS:CBG15177a	CBG15177a		[unknown]

0 RNAi Result

13 Allele

• WBVar00040219
• WBVar00040214
• WBVar00011904
• WBVar00122234
• WBVar00122233
• WBVar00122236
• WBVar00122235
• WBVar00122230
• WBVar00122232
• WBVar00122231
• WBVar00122227
• WBVar00122229
• WBVar00122228

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053123
• Remark: Cbr-zer-1, TGTTACAAGAACTGGTTTCCAACCCAATTACGACTCAAGACATTCGCCATCTTGCCAATA, WBGene00035501
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term