WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026872 Gene Name  CBG04137
Sequence Name  ? CBG04137 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: von Willebrand factor type A domain; SEA domain superfamily; von Willebrand factor A-like domain superfamily; von Willebrand factor, type A; and SEA domain. Is an ortholog of C. elegans R193.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04137.1 CBG04137.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04137 CBG04137   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00109025
WBVar00109026
WBVar00109024

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG04137, AAAGCTAGAAACGTCTGGCCTGATATCACAATTCTTGTTGACACTTCCATCAGTGCTGAT, WBGene00026872   Expr1051544 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term