WormMine: Gene WBGene00037103

• WormBase Gene ID: WBGene00037103
• Gene Name: Cbr-esyt-2
• Sequence Name: CBG17495
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C2 domain; Synaptotagmin, SMP domain; C2 domain superfamily; and Synaptotagmin-like mitochondrial-lipid-binding domain. Is an ortholog of C. elegans esyt-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17495b.1	CBG17495b.1		[unknown]
Transcript:CBG17495a.1	CBG17495a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17495a	CBG17495a		[unknown]
CDS:CBG17495b	CBG17495b		[unknown]

0 RNAi Result

5 Allele

• WBVar00043822
• WBVar00043827
• WBVar00043837
• WBVar00043832
• WBVar00043842

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056005
• Remark: Cbr-esyt-2, AGTCTTCTGAACCGTCAGCTCAGCCAACGATGGATCCCATTGTCCGTGGAGCGCAAATAA, WBGene00037103
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term