WormMine: Gene WBGene00024948

• WormBase Gene ID: WBGene00024948
• Gene Name: Cbr-tbc-9
• Sequence Name: CBG01761
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: EF-hand domain pair; GRAM domain; Rab-GTPase-TBC domain; Rab-GTPase-TBC domain superfamily; and PH-like domain superfamily. Is an ortholog of C. elegans tbc-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01761.1	CBG01761.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01761	CBG01761		[unknown]

0 RNAi Result

4 Allele

• WBVar00044129
• WBVar00044134
• WBVar00069531
• WBVar00069536

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063084
• Remark: CBG01761, GTATTCCTTTCTGCTATAAAGTTTGATGCTGCAGTACGGATTCTCGATTTATTCTTTTTC, WBGene00024948
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term