WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029461 Gene Name  Cbr-nlg-1
Sequence Name  ? CBG07402 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Carboxylesterase family; Carboxylesterase, type B; and Alpha/Beta hydrolase fold. Is an ortholog of C. elegans nlg-1. In C. elegans, nlg-1 is involved in gamma-aminobutyric acid receptor clustering and negative regulation of neurotransmitter secretion. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07402c.1 CBG07402c.1   [unknown]
Transcript:CBG07402d.1 CBG07402d.1   [unknown]
Transcript:CBG07402a.1 CBG07402a.1   [unknown]
Transcript:CBG07402b.1 CBG07402b.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07402c CBG07402c   [unknown]
CDS:CBG07402d CBG07402d   [unknown]
CDS:CBG07402a CBG07402a   [unknown]
CDS:CBG07402b CBG07402b   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00045739
WBVar00045749
WBVar00045744

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-nlg-1, TCCAGTACCAAACGTATAATTCGACTCACGGAGGACCAGGAGGAGCGGAACAATATAACA, WBGene00029461   Expr1056689 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term