WormMine: Gene WBGene00029461

• WormBase Gene ID: WBGene00029461
• Gene Name: Cbr-nlg-1
• Sequence Name: CBG07402
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Carboxylesterase family; Carboxylesterase, type B; and Alpha/Beta hydrolase fold. Is an ortholog of C. elegans nlg-1. In C. elegans, nlg-1 is involved in gamma-aminobutyric acid receptor clustering and negative regulation of neurotransmitter secretion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07402c.1	CBG07402c.1		[unknown]
Transcript:CBG07402d.1	CBG07402d.1		[unknown]
Transcript:CBG07402a.1	CBG07402a.1		[unknown]
Transcript:CBG07402b.1	CBG07402b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07402c	CBG07402c		[unknown]
CDS:CBG07402d	CBG07402d		[unknown]
CDS:CBG07402a	CBG07402a		[unknown]
CDS:CBG07402b	CBG07402b		[unknown]

0 RNAi Result

3 Allele

• WBVar00045739
• WBVar00045749
• WBVar00045744

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056689
• Remark: Cbr-nlg-1, TCCAGTACCAAACGTATAATTCGACTCACGGAGGACCAGGAGGAGCGGAACAATATAACA, WBGene00029461
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term