WormMine: Gene WBGene00039205

• WormBase Gene ID: WBGene00039205
• Gene Name: Cbr-phlp-2
• Sequence Name: CBG20149
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein phosphatase 2C; PPM-type phosphatase domain; Leucine-rich repeat; Leucine-rich repeat, typical subtype; PPM-type phosphatase domain superfamily; Leucine rich repeat; and Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans phlp-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20149.1	CBG20149.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20149	CBG20149		[unknown]

0 RNAi Result

16 Allele

• WBVar00049294
• WBVar00049274
• WBVar00049279
• WBVar00049284
• WBVar00049289
• WBVar00128257
• WBVar00028572
• WBVar00028577
• WBVar00028582
• WBVar00028552
• WBVar00028587
• WBVar00028557
• WBVar00028592
• WBVar00028562
• WBVar00028597
• WBVar00028567

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056499
• Remark: CBG20149, ATTCAATGAAACGCGAGATTTGTTGAGCAAATCGCTGAAGTTGAGCCCACCGAATACGGT, WBGene00039205
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term