WormMine: Gene WBGene00031443

• WormBase Gene ID: WBGene00031443
• Gene Name: Cbr-cyld-1
• Sequence Name: CBG09948
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Papain-like cysteine peptidase superfamily; CAP Gly-rich domain; CAP-Gly domain; and CAP Gly-rich domain superfamily. Is an ortholog of C. elegans cyld-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09948.1	CBG09948.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09948	CBG09948		[unknown]

0 RNAi Result

2 Allele

• WBVar00001684
• WBVar00115431

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068959
• Remark: Cbr-cyld-1, CAGATTGGTTATCTCTACAAGGATGGAATCGGTTGAAGGATGCAGATGAAACAGGGCAGA, WBGene00031443
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term