WormMine: Gene WBGene00035264

• WormBase Gene ID: WBGene00035264
• Gene Name: Cbr-tom-1
• Sequence Name: CBG14886
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans tom-1. In C. elegans, tom-1 is involved in several processes, including regulation of presynaptic dense core granule exocytosis; regulation of synaptic vesicle docking; and synaptic vesicle priming.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

7 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14886e.1	CBG14886e.1		[unknown]
Transcript:CBG14886d.1	CBG14886d.1		[unknown]
Transcript:CBG14886c.1	CBG14886c.1		[unknown]
Transcript:CBG14886b.1	CBG14886b.1		[unknown]
Transcript:CBG14886a.1	CBG14886a.1		[unknown]
Transcript:CBG14886g.1	CBG14886g.1		[unknown]
Transcript:CBG14886f.1	CBG14886f.1		[unknown]

Other

7 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14886a	CBG14886a		[unknown]
CDS:CBG14886b	CBG14886b		[unknown]
CDS:CBG14886c	CBG14886c		[unknown]
CDS:CBG14886d	CBG14886d		[unknown]
CDS:CBG14886e	CBG14886e		[unknown]
CDS:CBG14886f	CBG14886f		[unknown]
CDS:CBG14886g	CBG14886g		[unknown]

0 RNAi Result

5 Allele

• WBVar00001614
• WBVar00121842
• WBVar00121843
• WBVar00121844
• WBVar00121845

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070047
• Remark: Cbr-tom-1, ACATGGGTGTCAAAAATAACGCTGGAATGAATCCGATGCGTAGCGTGGCCCGTACAATTC, WBGene00035264
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term