WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026971 Gene Name  Cbr-tac-1
Sequence Name  ? CBG04258 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Transforming acidic coiled-coil-containing protein, C-terminal and Transforming acidic coiled-coil-containing protein (TACC), C-terminal. Is an ortholog of C. elegans tac-1. In C. elegans, tac-1 is involved in several processes, including regulation of microtubule polymerization or depolymerization; sexual reproduction; and spindle organization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04258.1 CBG04258.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04258 CBG04258   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00001397
WBVar00001392
WBVar00001387

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-tac-1, ACGATATCGAAATTGCGAGTAAAGACGAGGAGATTCGTGTGCTGAAGAAACGTGTCGAAG, WBGene00026971   Expr1055391 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term