WormMine: Gene WBGene00034755

• WormBase Gene ID: WBGene00034755
• Gene Name: Cbr-sul-1
• Sequence Name: CBG14172
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Sulfatase; Sulfatase, N-terminal; and Alkaline-phosphatase-like, core domain superfamily. Is an ortholog of C. elegans sul-1. In C. elegans, sul-1 is involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14172a.1	CBG14172a.1		[unknown]
Transcript:CBG14172b.1	CBG14172b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14172b	CBG14172b		[unknown]
CDS:CBG14172a	CBG14172a		[unknown]

0 RNAi Result

4 Allele

• WBVar00002109
• WBVar00017137
• WBVar00029199
• WBVar00029204

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059910
• Remark: Cbr-sul-1, AGGCAAAAATATGCCATACGAGTTTGATATTCGAGTGCCATTTTTTATGAGAGGCCCTGG, WBGene00034755
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term