WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028330 Gene Name  CBG05980
Sequence Name  ? CBG05980 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Amino acid transporter, transmembrane domain and Transmembrane amino acid transporter protein. Is an ortholog of C. elegans F13H10.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05980a.1 CBG05980a.1   [unknown]
Transcript:CBG05980b.1 CBG05980b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05980b CBG05980b   [unknown]
CDS:CBG05980a CBG05980a   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00006047

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG05980, AAAAGTATGCCCATTATGGAATCGTTGCGGTTGGTGTTCTGAATCTTATTGCTCAATTTG, WBGene00028330   Expr1054223 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term