WormMine: Gene WBGene00027904

• WormBase Gene ID: WBGene00027904
• Gene Name: Cbr-sfrp-1
• Sequence Name: CBG05456
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Frizzled cysteine-rich domain superfamily; Frizzled domain; Fz domain; Frizzled/secreted frizzled-related protein; and Tissue inhibitor of metalloproteinases-like, OB-fold. Is an ortholog of C. elegans sfrp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05456.1	CBG05456.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05456	CBG05456		[unknown]

0 RNAi Result

5 Allele

• WBVar00110602
• WBVar00110605
• WBVar00110603
• WBVar00110604
• WBVar00015339

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052166
• Remark: CBG05456, TTATCGACGTCCGCATTATTACGAAATGAGACGTCATAATACGGGAAGATACCAGATGTT, WBGene00027904
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term