WormMine: Gene WBGene00027834

• WormBase Gene ID: WBGene00027834
• Gene Name: Cbr-dyci-1
• Sequence Name: CBG05374
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans dyci-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05374.1	CBG05374.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05374	CBG05374		[unknown]

0 RNAi Result

4 Allele

• WBVar00110498
• WBVar00110499
• WBVar00110497
• WBVar00013204

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069875
• Remark: Cbr-dyci-1, CGACTGGACCATCAAATTATGGAGCACCAAGGATGCAAATCTGAAGTTCTCCTTTGAATC, WBGene00027834
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term