WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027759 Gene Name  Cbr-hpl-1
Sequence Name  ? CBG05267 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Chromo-like domain superfamily; Chromo domain; Chromo (CHRromatin Organisation MOdifier) domain; and Chromo/chromo shadow domain. Is an ortholog of C. elegans hpl-1. In C. elegans, hpl-1 is involved in several processes, including developmental process involved in reproduction; negative regulation of Ras protein signal transduction; and negative regulation of vulval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05267.1 CBG05267.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05267 CBG05267   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00110218

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG05267, AAAGGTGCATGGTCTCACGACAGCATCAGGGAAACTTCAATATTTGTGTTGTTTTGTGGA, WBGene00027759   Expr1062687 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term