WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033332 Gene Name  Cbr-phip-1
Sequence Name  ? CBG12374 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Janus superfamily; Janus; and Janus/Ocnus family (Ocnus). Is an ortholog of C. elegans phip-1. In C. elegans, phip-1 is involved in positive regulation of axon regeneration. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12374.1 CBG12374.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12374 CBG12374   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00008944
WBVar00118466

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG12374, TTGACATTTTGAAGCAGAAGTATACCGATTATCACATTGATTTCTCCAACGACGGATACT, WBGene00033332   Expr1055457 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term