WormMine: Gene WBGene00033332

• WormBase Gene ID: WBGene00033332
• Gene Name: Cbr-phip-1
• Sequence Name: CBG12374
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Janus superfamily; Janus; and Janus/Ocnus family (Ocnus). Is an ortholog of C. elegans phip-1. In C. elegans, phip-1 is involved in positive regulation of axon regeneration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12374.1	CBG12374.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12374	CBG12374		[unknown]

0 RNAi Result

2 Allele

• WBVar00008944
• WBVar00118466

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055457
• Remark: CBG12374, TTGACATTTTGAAGCAGAAGTATACCGATTATCACATTGATTTCTCCAACGACGGATACT, WBGene00033332
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term