WormMine: Gene WBGene00029573

• WormBase Gene ID: WBGene00029573
• Gene Name: Cbr-atrn-1
• Sequence Name: CBG07577
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Kelch-type beta propeller; Galactose oxidase/kelch, beta-propeller; EGF-like domain; CUB domain; Laminin EGF domain; Kelch motif; Kelch repeat type 1; PSI domain; Laminin-type EGF domain; Spermadhesin, CUB domain superfamily; Galactose oxidase, central domain; and Plexin repeat. Is an ortholog of C. elegans atrn-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07577.1	CBG07577.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07577	CBG07577		[unknown]

0 RNAi Result

1 Allele

• WBVar00008342

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070121
• Remark: Cbr-tag-53, CCCATCTTCAACTTTTCTATTTTCAGATGAGCTAGCTGTTGACTTCATTTTCACATTCAA, WBGene00029573
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term