WormMine: Gene WBGene00029675

• WormBase Gene ID: WBGene00029675
• Gene Name: Cbr-gob-1
• Sequence Name: CBG07712
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Trehalose-6-phosphate phosphatase, helical bundle domain; Trehalose-6-phosphate phosphatase N-terminal helical bundle domain; HAD superfamily; and HAD-like superfamily. Is an ortholog of C. elegans gob-1. In C. elegans, gob-1 is involved in carbohydrate derivative catabolic process and trehalose biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07712.1	CBG07712.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07712	CBG07712		[unknown]

0 RNAi Result

7 Allele

• WBVar00112754
• WBVar00112753
• WBVar00050604
• WBVar00050609
• WBVar00050614
• WBVar00019694
• WBVar00019699

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065650
• Remark: Cbr-gob-1, GAAAAGTATGTGTTGCTGGAGATACCACGAGTGACCTTCCAATGCTTCAAAAGGCAGCCC, WBGene00029675
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term