WormMine: Gene WBGene00030798

• WormBase Gene ID: WBGene00030798
• Gene Name: Cbr-mfsd-6
• Sequence Name: CBG09151
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: MFS_1 like family; Major facilitator superfamily associated domain; and MFS transporter superfamily. Is an ortholog of C. elegans mfsd-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09151.1	CBG09151.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09151	CBG09151		[unknown]

0 RNAi Result

23 Allele

• WBVar00114558
• WBVar00114557
• WBVar00114559
• WBVar00114561
• WBVar00114560
• WBVar00114565
• WBVar00114564
• WBVar00114563
• WBVar00114562
• WBVar00114568
• WBVar00114567
• WBVar00114566
• WBVar00056749
• WBVar00056769
• WBVar00056764
• WBVar00056759
• WBVar00056754
• WBVar00056784
• WBVar00056774
• WBVar00056779
• WBVar00025499
• WBVar00025489
• WBVar00025494

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056650
• Remark: CBG09151, CAAAATCACCGACGCCTTCAACGCCACCACCGTAGTCAACGCCAACTATGGCGCCATAGC, WBGene00030798
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term