WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030449 Gene Name  CBG08702
Sequence Name  ? CBG08702 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Carboxylesterase family; Carboxylesterase, type B; Esterase CM06B1-like; and Alpha/Beta hydrolase fold. Is an ortholog of C. elegans cest-35.1 and cest-35.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08702.1 CBG08702.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08702 CBG08702   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00113912
WBVar00113911

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG08702, ACAACTGAAGAAGAATTGAGCGTGATGGATATGATGGGAACTTTTGTGGCTAACTTTGCT, WBGene00030449   Expr1067820 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term