WormMine: Gene WBGene00030345

• WormBase Gene ID: WBGene00030345
• Gene Name: Cbr-scc-3
• Sequence Name: CBG08584
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Armadillo-type fold; Cohesin subunit Scc3/SA; STAG; and STAG domain. Is an ortholog of C. elegans scc-3. In C. elegans, scc-3 is involved in meiotic sister chromatid cohesion; nuclear division; and regulation of DNA damage checkpoint.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08584.1	CBG08584.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08584	CBG08584		[unknown]

0 RNAi Result

1 Allele

• WBVar00113815

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052209
• Remark: Cbr-scc-3, ACAAAGGAGATGCTATGCCTCCGAACATGCACTTCCTTGAAATCGCAATTGAATTCAGCG, WBGene00030345
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term