WormMine: Gene WBGene00032397

• WormBase Gene ID: WBGene00032397
• Gene Name: CBG11242
• Sequence Name: CBG11242
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: von Willebrand factor A-like domain superfamily. Is an ortholog of C. elegans T19D12.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11242c.1	CBG11242c.1		[unknown]
Transcript:CBG11242d.1	CBG11242d.1		[unknown]
Transcript:CBG11242a.1	CBG11242a.1		[unknown]
Transcript:CBG11242b.1	CBG11242b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11242c	CBG11242c		[unknown]
CDS:CBG11242b	CBG11242b		[unknown]
CDS:CBG11242a	CBG11242a		[unknown]
CDS:CBG11242d	CBG11242d		[unknown]

0 RNAi Result

8 Allele

• WBVar00116700
• WBVar00116701
• WBVar00116702
• WBVar00116703
• WBVar00116696
• WBVar00116697
• WBVar00116698
• WBVar00116699

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068573
• Remark: CBG11242, TAAATATTCTCTTCAAATCGGAGCCGGAAACGATGATGCTGTTGCTGCTACAATCGCTAG, WBGene00032397
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term