WormMine: Gene WBGene00032052

• WormBase Gene ID: WBGene00032052
• Gene Name: Cbr-mes-3
• Sequence Name: CBG10773
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans mes-3. In C. elegans, mes-3 is involved in regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10773.1	CBG10773.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10773	CBG10773		[unknown]

0 RNAi Result

12 Allele

• WBVar00116124
• WBVar00116125
• WBVar00116126
• WBVar00116127
• WBVar00116122
• WBVar00116123
• WBVar00116128
• WBVar00116129
• WBVar00116130
• WBVar00116131
• WBVar00116132
• WBVar00116133

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067272
• Remark: Cbr-mes-3, ACTACACTGCACCACGCGACAAGTATCTCGATCTTAAGAAGAAGTGGACTGAGCAACATT, WBGene00032052
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term