WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032896 Gene Name  Cbr-spr-4
Sequence Name  ? CBG11849 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Zinc finger C2H2-type and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans spr-4. In C. elegans, spr-4 is involved in regulation of transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11849.1 CBG11849.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11849 CBG11849   [unknown]

0 RNAi Result

4 Allele

Public Name
WBVar00117904
WBVar00117905
 
WBVar00015394

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-spr-4, ATGAGCCGAATGCCGAGGAGACGATCTCGTTTTTGAGCATGGGCATTATGCCGCCAAGAA, WBGene00032896   Expr1057759 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_downregulated
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

0 Sequence

1 Sequence Ontology Term