WormMine: Gene WBGene00032898

• WormBase Gene ID: WBGene00032898
• Gene Name: Cbr-rme-8
• Sequence Name: CBG11852
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: DnaJ domain; Chaperone J-domain superfamily; Armadillo-type fold; GYF domain 2; and Armadillo-like helical. Is an ortholog of C. elegans rme-8. In C. elegans, rme-8 is involved in several processes, including mechanosensory behavior; positive regulation of nematode male tail tip morphogenesis; and vesicle-mediated transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11852b.1	CBG11852b.1		[unknown]
Transcript:CBG11852a.1	CBG11852a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11852a	CBG11852a		[unknown]
CDS:CBG11852b	CBG11852b		[unknown]

0 RNAi Result

5 Allele

• WBVar00117937
• WBVar00117939
• WBVar00117938
• WBVar00117940
• WBVar00117941

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058292
• Remark: Cbr-rme-8, GCGATTTTGGATTTGAAAGTGGGAACGAAGATTCAGGAGATACTTGAGAAGAGCCCCATT, WBGene00032898
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term