WormMine: Gene WBGene00029681

• WormBase Gene ID: WBGene00029681
• Gene Name: Cbr-lron-3
• Sequence Name: CBG07723
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat; Leucine-rich repeat domain superfamily; Cysteine-rich flanking region, C-terminal; and Leucine rich repeat. Is an ortholog of C. elegans lron-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07723.1	CBG07723.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07723	CBG07723		[unknown]

0 RNAi Result

17 Allele

• WBVar00050674
• WBVar00050679
• WBVar00050649
• WBVar00050644
• WBVar00050634
• WBVar00050639
• WBVar00050669
• WBVar00050664
• WBVar00050659
• WBVar00050654
• WBVar00050624
• WBVar00050629
• WBVar00019709
• WBVar00019714
• WBVar00019719
• WBVar00019724
• WBVar00019704

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060587
• Remark: CBG07723, TCCGGAATCAATTTTACTGCGATTGCAACTCCAAAGATTTCATAACTTGGCTACGTTCGA, WBGene00029681
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term