WormMine: Gene WBGene00034108

• WormBase Gene ID: WBGene00034108
• Gene Name: CBG13329
• Sequence Name: CBG13329
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function (DUF4507) and Protein of unknown function DUF4507. Is an ortholog of C. elegans Y56A3A.31.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13329b.1	CBG13329b.1		[unknown]
Transcript:CBG13329a.1	CBG13329a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13329a	CBG13329a		[unknown]
CDS:CBG13329b	CBG13329b		[unknown]

0 RNAi Result

3 Allele

• WBVar00119573
• WBVar00119572
• WBVar00119574

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062341
• Remark: CBG13329, ATGTATATGCTACTTCCTGTTCCGATGGCATATTGATGTGCTCGCAAATGCAGACAGAAA, WBGene00034108
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term