WormMine: Gene WBGene00030813

• WormBase Gene ID: WBGene00030813
• Gene Name: Cbr-cls-1
• Sequence Name: CBG09173
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: CLASP N-terminal domain; Armadillo-type fold; HEAT repeat; CLASP N terminal; Armadillo-like helical; and TOG domain. Is an ortholog of C. elegans cls-1. In C. elegans, cls-1 is involved in microtubule cytoskeleton organization and positive regulation of microtubule depolymerization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09173a.1	CBG09173a.1		[unknown]
Transcript:CBG09173b.1	CBG09173b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09173b	CBG09173b		[unknown]
CDS:CBG09173a	CBG09173a		[unknown]

0 RNAi Result

2 Allele

• WBVar00056884
• WBVar00056879

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065142
• Remark: CBG09173, TACAACGCGTTGGGATGCCCAGATTGGAGACGCATTTGAGAAAATTGAATGCGACAAAGG, WBGene00030813
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term