WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030813 Gene Name  Cbr-cls-1
Sequence Name  ? CBG09173 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: CLASP N-terminal domain; Armadillo-type fold; HEAT repeat; CLASP N terminal; Armadillo-like helical; and TOG domain. Is an ortholog of C. elegans cls-1. In C. elegans, cls-1 is involved in microtubule cytoskeleton organization and positive regulation of microtubule depolymerization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09173a.1 CBG09173a.1   [unknown]
Transcript:CBG09173b.1 CBG09173b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09173b CBG09173b   [unknown]
CDS:CBG09173a CBG09173a   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00056884
WBVar00056879

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG09173, TACAACGCGTTGGGATGCCCAGATTGGAGACGCATTTGAGAAAATTGAATGCGACAAAGG, WBGene00030813   Expr1065142 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term