WormMine: Gene WBGene00036316

• WormBase Gene ID: WBGene00036316
• Gene Name: Cbr-osm-1
• Sequence Name: CBG16355
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; Tetratricopeptide-like helical domain superfamily; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans osm-1. In C. elegans, osm-1 is involved in dauer entry and non-motile cilium assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16355.1	CBG16355.1		[unknown]
Transcript:CBG16355.2	CBG16355.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16355	CBG16355		[unknown]

0 RNAi Result

20 Allele

• WBVar00056003
• WBVar00123820
• WBVar00123822
• WBVar00123821
• WBVar00123824
• WBVar00123823
• WBVar00123825
• WBVar00024859
• WBVar00024829
• WBVar00024799
• WBVar00024834
• WBVar00024804
• WBVar00024839
• WBVar00024809
• WBVar00024844
• WBVar00024814
• WBVar00024849
• WBVar00024819
• WBVar00024854
• WBVar00024824

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061988
• Remark: Cbr-osm-1, GCCATTGAAGAAGGAAGTGGAGAGCTTGTGGATTACAGTCCGTTCGAGAACAGTGACATT, WBGene00036316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term