WormMine: Gene WBGene00034550

• WormBase Gene ID: WBGene00034550
• Gene Name: Cbr-eps-8
• Sequence Name: CBG13858
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Epidermal growth factor receptor kinase substrate 8-like; SAM domain; Tensin/EPS8 phosphotyrosine-binding domain; Phosphotyrosine-binding domain; PTB/PI domain; Sterile alpha motif/pointed domain superfamily; SH3-like domain superfamily; SAM domain (Sterile alpha motif); SH3 domain; and PH-like domain superfamily. Is an ortholog of C. elegans eps-8. In C. elegans, eps-8 is involved in several processes, including anatomical structure morphogenesis; barbed-end actin filament capping; and supramolecular fiber organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13858a.1	CBG13858a.1		[unknown]
Transcript:CBG13858b.1	CBG13858b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13858a	CBG13858a		[unknown]
CDS:CBG13858b	CBG13858b		[unknown]

0 RNAi Result

11 Allele

• WBVar00057904
• WBVar00057909
• WBVar00057894
• WBVar00057899
• WBVar00016007
• WBVar00026414
• WBVar00026399
• WBVar00026419
• WBVar00026404
• WBVar00026424
• WBVar00026409

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067506
• Remark: Cbr-eps-8, GTGCAAGAACATGCATCAGAGAGTTGGATATGTTCCACATACGATTTTGTCAATGGTGCC, WBGene00034550
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term