WormMine: Gene WBGene00024919

• WormBase Gene ID: WBGene00024919
• Gene Name: CBG01728
• Sequence Name: CBG01728
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Methyltransferase domain and S-adenosyl-L-methionine-dependent methyltransferase. Is an ortholog of C. elegans F29B9.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01728a.1	CBG01728a.1		[unknown]
Transcript:CBG01728b.1	CBG01728b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01728a	CBG01728a		[unknown]
CDS:CBG01728b	CBG01728b		[unknown]

0 RNAi Result

5 Allele

• WBVar00069436
• WBVar00015134
• WBVar00069441
• WBVar00069431
• WBVar00069446

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063740
• Remark: CBG01728, GATTGACAGGAGTTGATTACTGTCAAAAAGCAGTCGATCTGTCGAATGCGGCTTCGAAAG, WBGene00024919
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term