WormMine: Gene WBGene00024408

• WormBase Gene ID: WBGene00024408
• Gene Name: Cbr-irld-30
• Sequence Name: CBG01133
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Receptor L domain; Receptor L-domain; and Receptor L-domain superfamily. Is an ortholog of C. elegans irld-30.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01133.1	CBG01133.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01133	CBG01133		[unknown]

0 RNAi Result

2 Allele

• WBVar00018689
• WBVar00018694

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064816
• Remark: CBG01133, ATTGGTTATCAATTCCAAAAATGTGCAAAATGTACAAAAATTGAGCTCGGTGGAAATCAT, WBGene00024408
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term