WormMine: Gene WBGene00026532

• WormBase Gene ID: WBGene00026532
• Gene Name: Cbr-rig-5
• Sequence Name: CBG03733
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin I-set; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin domain; Immunoglobulin subtype 2; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans rig-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03733b.1	CBG03733b.1		[unknown]
Transcript:CBG03733a.1	CBG03733a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03733a	CBG03733a		[unknown]
CDS:CBG03733b	CBG03733b		[unknown]

0 RNAi Result

1 Allele

• WBVar00017619

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060713
• Remark: Cbr-rig-5, GAATATGTGTGTGTGGCAAGCAATGGAATACCTCCAGACGAATCTTGGACTGTCAAACTT, WBGene00026532
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term