WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033987 Gene Name  Cbr-tra-1
Sequence Name  ? CBG13188 Brief Description  Cbr-tra-1 encodes a Gli/Ci-related zinc-finger transcription factor that is orthologous to C. elegans TRA-1; like in C. elegans, mutations in Cbr-tra-1 result in sexual cell fate transformations of XX hermaphrodites to male fates such as one-armed gonads, masculinized tails, and varying degrees of male mating behavior.
Organism  Caenorhabditis briggsae Automated Description  Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans tra-1. In C. elegans, tra-1 is involved in developmental process involved in reproduction; negative regulation of transcription by RNA polymerase II; and positive regulation of neuron apoptotic process.
Biotype  SO:0001217 Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13188b.1 CBG13188b.1   [unknown]
Transcript:CBG13188a.1 CBG13188a.1   [unknown]
Transcript:CBG13188c.1 CBG13188c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13188c CBG13188c   [unknown]
CDS:CBG13188b CBG13188b   [unknown]
CDS:CBG13188a CBG13188a   [unknown]

0 RNAi Result

4 Allele

Public Name
nm30
nm10
nm2
nm1

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-tra-1, CCTCCCTTCGCAAGCACATCAAAGCAGTTCATGGAGACGAGGAGTACGAGAAGGCAAAGA, WBGene00033987   Expr1051404 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term