WormMine: Gene WBGene00032217

• WormBase Gene ID: WBGene00032217
• Gene Name: Cbr-lact-1
• Sequence Name: CBG11006
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Beta-lactamase/transpeptidase-like; Beta-lactamase; and Beta-lactamase-related. Is an ortholog of C. elegans lact-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11006.1	CBG11006.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11006	CBG11006		[unknown]

0 RNAi Result

1 Allele

• WBVar00012492

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053360
• Remark: Cbr-lact-1, CTACGTATCAAATGGAATGAAAATCACTGACGCGGATATGGTGGAGCCGTGGAGAAATCT, WBGene00032217
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term