WormMine: Gene WBGene00031911

• WormBase Gene ID: WBGene00031911
• Gene Name: Cbr-denn-4
• Sequence Name: CBG10547
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Tetratricopeptide-like helical domain superfamily; DENN domain, C-terminal lobe; Pentatricopeptide repeat; dDENN domain; cDENN domain; uDENN domain; and DENN (AEX-3) domain. Is an ortholog of C. elegans denn-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10547a.1	CBG10547a.1		[unknown]
Transcript:CBG10547b.1	CBG10547b.1		[unknown]
Transcript:CBG10547c.1	CBG10547c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10547c	CBG10547c		[unknown]
CDS:CBG10547b	CBG10547b		[unknown]
CDS:CBG10547a	CBG10547a		[unknown]

0 RNAi Result

1 Allele

• WBVar00012202

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066393
• Remark: CBG10547, TTCGGTGAATAAGAATATGCTATTCAAAGCGGTTCAGGAGTTGGTCAACTCGTCGAGACT, WBGene00031911
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term