WormMine: Gene WBGene00034378

• WormBase Gene ID: WBGene00034378
• Gene Name: CBG13640
• Sequence Name: CBG13640
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: S phase cyclin A-associated protein in the endoplasmic reticulum and S phase cyclin A-associated protein in the endoplasmic reticulum, N-terminal. Is an ortholog of C. elegans Y6B3B.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13640.1	CBG13640.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13640	CBG13640		[unknown]

0 RNAi Result

15 Allele

• WBVar00015597
• WBVar00120180
• WBVar00120181
• WBVar00120182
• WBVar00120183
• WBVar00120184
• WBVar00120185
• WBVar00120186
• WBVar00120177
• WBVar00120178
• WBVar00120179
• WBVar00120190
• WBVar00120187
• WBVar00120188
• WBVar00120189

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065252
• Remark: CBG13640, TTCACATTCTCCTCCATAAAATCCCAATCCGCCTACTCTCGATTGGAAAACACGCGAAAC, WBGene00034378
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term