WormMine: Gene WBGene00034454

• WormBase Gene ID: WBGene00034454
• Gene Name: CBG13740
• Sequence Name: CBG13740
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class r (Str) and Serpentine type 7TM GPCR chemoreceptor Str. Is an ortholog of C. elegans C03H5.7 and C03H5.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13740.1	CBG13740.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13740	CBG13740		[unknown]

0 RNAi Result

8 Allele

• WBVar00120270
• WBVar00120271
• WBVar00120269
• WBVar00016879
• WBVar00016874
• WBVar00016864
• WBVar00016869
• WBVar00016859

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052691
• Remark: CBG13740, CATCGAACGAAATGTGCTCTACGTCTTCTCCACCATCAAGCCTCAATTCATGTCCAAAAC, WBGene00034454
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term