WormMine: Gene WBGene00035792

• WormBase Gene ID: WBGene00035792
• Gene Name: CBG15624
• Sequence Name: CBG15624
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Inhibitor of apoptosis-promoting Bax1; Bax inhibitor 1-related; and MFS transporter superfamily. Is an ortholog of C. elegans Y42H9AR.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15624.1	CBG15624.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15624	CBG15624		[unknown]

0 RNAi Result

2 Allele

• WBVar00018932
• WBVar00018927

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1067613
• Remark: CBG15624, AAATCTCCCCAGAAGAGTACATTTTCGCTGCCACACATGTATTCGTCGACATTTTGACAA, WBGene00035792
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term