WormMine: Gene WBGene00034600

• WormBase Gene ID: WBGene00034600
• Gene Name: CBG13921
• Sequence Name: CBG13921
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class d (Srd) and Serpentine type 7TM GPCR chemoreceptor Srd. Is an ortholog of C. elegans Y77E11A.16.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13921.1	CBG13921.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13921	CBG13921		[unknown]

0 RNAi Result

5 Allele

• WBVar00016492
• WBVar00016497
• WBVar00016512
• WBVar00016502
• WBVar00016507

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065430
• Remark: CBG13921, CTTTATCATTTGGAATTCATTGATGTCACTGTAGCGGAATACTTGGTTTACACACTTTTT, WBGene00034600
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term