WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036963 Gene Name  Cbr-ftt-2
Sequence Name  ? CBG17289 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: 14-3-3 protein; 14-3-3 domain superfamily; and 14-3-3 domain. Is an ortholog of C. elegans ftt-2. In C. elegans, ftt-2 is involved in cytoplasmic sequestering of protein; dauer larval development; and negative regulation of protein import into nucleus. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG17289.1 CBG17289.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG17289 CBG17289   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00018394
WBVar00018389

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ftt-2, GAGAAGTCGCAACAGAGCTACCAAGAGGCGTTCGACATCGCCAAGGAGAAGATGCAGCCA, WBGene00036963   Expr1059288 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term