WormMine: Gene WBGene00035249

• WormBase Gene ID: WBGene00035249
• Gene Name: Cbr-hot-5
• Sequence Name: CBG14866
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Caenorhabditis elegans ly-6-related and Caenorhabditis elegans ly-6-related protein. Is an ortholog of C. elegans hot-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14866.1	CBG14866.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14866	CBG14866		[unknown]

0 RNAi Result

20 Allele

• WBVar00121809
• WBVar00121800
• WBVar00121801
• WBVar00121802
• WBVar00121803
• WBVar00121804
• WBVar00121805
• WBVar00121806
• WBVar00121807
• WBVar00121808
• WBVar00121810
• WBVar00121811
• WBVar00121812
• WBVar00121813
• WBVar00121814
• WBVar00121815
• WBVar00121816
• WBVar00121817
• WBVar00121798
• WBVar00121799

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052250
• Remark: Cbr-hot-5, AAATAGTGCAAGTGTGCTCCTGTGACAAAGACGGATGTAATTTCGACTCGATCAACGATT, WBGene00035249
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term