WormMine: Gene WBGene00035049

• WormBase Gene ID: WBGene00035049
• Gene Name: CBG14610
• Sequence Name: CBG14610
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans C42D8.1. In C. elegans, C42D8.1 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14610a.1	CBG14610a.1		[unknown]
Transcript:CBG14610b.1	CBG14610b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14610b	CBG14610b		[unknown]
CDS:CBG14610a	CBG14610a		[unknown]

0 RNAi Result

1 Allele

• WBVar00121552

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058677
• Remark: CBG14610, CGGGATCGATGCATTCAACAACGACCAATACTAAACGTTCAATGGATTTTATTTTCTCTG, WBGene00035049
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term