WormMine: Gene WBGene00038664

• WormBase Gene ID: WBGene00038664
• Gene Name: CBG19445
• Sequence Name: CBG19445
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: CUB-like domain. Is an ortholog of C. elegans T05E12.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19445.1	CBG19445.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19445	CBG19445		[unknown]

0 RNAi Result

12 Allele

• WBVar00127471
• WBVar00127470
• WBVar00127475
• WBVar00127474
• WBVar00127473
• WBVar00127472
• WBVar00127469
• WBVar00127464
• WBVar00127468
• WBVar00127467
• WBVar00127466
• WBVar00127465

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060510
• Remark: CBG19445, ACATTACGGGAACAGGTACACTGGAGGTTTACTATGGAGGAATAACAGAGTCCAAGAGCA, WBGene00038664
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term